Show all answers
Hide all answers
  • What is nG6?

    nG6 is a Next Generation Sequencing data repository allowing to store raw data and associated analyses.

    nG6 uses project, run and analysis levels. A run represents a sequencing unit (e.g. a lane of an Illumina flowcell or a region of a Roche 454 PTP). Analyses are linked to a run, and a project contains one or more runs, as well as analyses.

    nG6 frontend access is restricted by a login form.

    You can learn more about nG6 reading the publication in BMC Genomics.

  • What about user management?

    User access is managed at the project level. Three roles exist : 

    • a "Member" can access and download run and analysis data linked to a project
    • a "Manager" has "Member" rights and can add or remove users from the project he manages (e.g. it allows a researcher to give access to their NGS data to a bioinformatician)
    • an "Administrator" has "Manager" right and can add or remove runs and/or analysis to the project

    Each user can update its contact information and/or password : 

    • connect to ng6
    • enter a project
    • click the "Users" tab
    • check the checkbox of the account to modify
    • click the "Update User" button
    • change the contact information and/or the password in the form
    • click the "Save" button

    If the NGS data was produced on the GeT-PlaGe core facility, the research team login from GeT-PlaGe has to be used to connect to nG6, with the same password (synchronization from GeT-PlaGe database to nG6 database is done every 20 minutes). Please note that for these accounts, the reference database is the one from GeT-PlaGe and the contact information and/or password must be updated connecting to http://get.genotoul.fr/index.php?id=209.

  • How to add a user to my project?

    If you want to give access to your data in nG6 to your colleagues, you can add users : 

    • Connect to ng6 frontend
    • click on "Projects" menu
    • click on the project you want to share
    • click on "Users" tab
    • click on the "Add user" button
    • Fill in the form, for each input of the form (last and first names, login, e-mail), nG6 will suggest a list of account of its database corresponding to the characters you entered
      • if the user you want to add has already an account in nG6, select its account in one of the dropdown boxes
        • nG6 will fill in the whole form as you can check that the account you selected is the one you expected. If you agree, click on the "Add" button
      • if the user you want to add does not have an account in nG6, fill in all he inputs of the form and click on the "Add" button

    Note : an Administrator can add a user with administrator, Manager or Member role. A Manager can add a user with Manager or Member role.

    To remove a user from a project, check the select box of the corresponding user and click on the "Delete user" button

  • How to get my data?

    Several solutions are available : 

    On Run/Analysis page : while accessing your runs/analysis, you can download the files by clicking the available html links in "Download" section, but be aware that if the file is too heavy, the download can take a long time


    On Download page : select the data you want to access by clicking the corresponding checkboxes inside the project/run. Then, at top of the page on available downloads field : select your download method. They are described below. Finally validate the form with "Download".

    Archive :a dialog box will ask you your e-mail address. The archive file will be created asynchronously and an e-mail will be sent once done. Warning : The total size of selected data cannot exceed 100 Mo for archive downloading

    URL : A url list of each file of your project will de created

    • On Unix server, copy/paste this list in a file "listOfFiles" (Be aware that if the same filename is found in different url, the local file will be overriden). Then, use one of the following command to download all the files :
    wget -i listOfFiles

     

    cat listOfFiles | xargs -i curl -O {}
    • On a Windows workstation, copy/paste this list in a file "listOfFiles" (Be aware that if the same filename is found in different url, the local file will be overriden). Then you can download curl for Windows (https://curl.haxx.se/download.html), extract the archive, and run this following command in a windows prompt
    FOR /F %file in (listOfFiles) DO pathToCurl.exe %file

    Symbolic Link : a dialog box asks you

    1. a login/password couple existing in the Bioinformatics Genotoul platform
    2. a repository where the symbolic links will be created on the genotoul server. It should be :
      • on the /work space
      • on a folder where YOU can access in writing mode, eg. /work/user/projectX/

    The data is written in one folder per project + one folder per run + one folder par analyze. You can then analyze your data on the genotoul infrastructure or download them. Dowloading the data can be achieved :  

    • From the genologin cluster
      1. Connect on the Bioinformatics Genotoul server : ssh your_login@genologin.toulouse.inra.fr
      2. Connect on a node of the cluster : srun --pty bash
      3. Run the command : rsync -avLh /work/pathToYourTopFolderWithSymbolicLinks your_server_login@your_server_name:/path_on_your_server
    • From your windows/Mac workstation, use a GUI like FileZilla to transfer your data from genologin.toulouse.inra.fr (cf"Files transfert from/to the platform" FAQ entry on the bioinfo.genotoul.fr website) 

    If you want to create a Bioinformatics Genotoul platform user account, please see http://bioinfo.genotoul.fr/index.php/ask-for/create-an-account/

  • Data storage and security policy

    Your data is stored on a Dell NAS in the INRA campus, replicated once a day on another Dell NAS stored in a datacenter in a distant site.

    Passwords in the database are hashed and the communication between your browser and nG6 is encrypted.

  • How long are my data stored?

    By default, the data (raw data as well as data related to analyzes) added to ng6 by GeT-PlaGe core-facility is stored during 3 months and then will be automatically deleted. For collaborations, data can be stored longer.

    The information concerning data storage policy can be found in the contract signed between the laboratory and GeT-PlaGe

    This policy is in place since January, 1st of 2019, for the new contracts. For contracts signed before 2019, the data is stored for two years and will be automatically deleted.

  • What are the adapter sequences used with Illumina technology?

    When the library insert length is smaller than the sequencing read length, you can find the sequencing adapaters the end of your reads.

    You can find the different sequencing adapters below :

    • TruSeq Adapter - Read 1 : "GATCGGAAGAG-CACACGTCTGAACTCCAGTC"
    • Illumina single End PCR Primer - Read 2 : "GATCGGAAGAG-CGTCGTGTAGGGAAAGAGTG"
    • Nextera  transposase sequence - Read 1 : 5’ TCGTCGGCAGCGTC-AGATGTGTATAAGAGACAG
    • Nextera  transposase sequence - Read 2 : 5’ GTCTCGTGGGCTCGG-AGATGTGTATAAGAGACAG

    You can use cutadapt to remove the adapter sequences, specifying the following sequences : 

    • Nextera index : CTGTCTCTTATACACATCT
    • Illlumina Index : AGATCGGAAGAGC
  • What are the adapter sequences used with Oxford Nanopore technology?

     

    Today (03/05/2019), Nanopore reads on nG6 can contain the adapters and barcodes.

    You can find the different sequencing adapters for the Ligation Sequencing Kit (kit code SQK-LSK109) below :

    Adapter Y top:

    5'- GGCGTCTGCTTGGGTGTTTAACCTTTTTTTTTTAATGTACTTCGTTCAGTTACGTATTGCT -3'

    Adapter Y bottom:

    5'- GCAATACGTAACTGAACGAAGT -3'

     

    You can find the different barcoding sequences :

    Only for multiplexed run !

    Native Barcoding Expansion 1-12

    ComponentSequence
    NB01CACAAAGACACCGACAACTTTCTT
    NB02ACAGACGACTACAAACGGAATCGA
    NB03CCTGGTAACTGGGACACAAGACTC
    NB04TAGGGAAACACGATAGAATCCGAA
    NB05AAGGTTACACAAACCCTGGACAAG
    NB06GACTACTTTCTGCCTTTGCGAGAA
    NB07AAGGATTCATTCCCACGGTAACAC
    NB08ACGTAACTTGGTTTGTTCCCTGAA
    NB09AACCAAGACTCGCTGTGCCTAGTT
    NB10GAGAGGACAAAGGTTTCAACGCTT
    NB11TCCATTCCCTCCGATAGATGAAAC
    NB12TCCGATTCTGCTTCTTTCTACCTG

     

    Native Barcoding Expansion 13-24

    ComponentSequence
    NB13TCACACGAGTATGGAAGTCGTTCT
    NB14TCTATGGGTCCCAAGAGACTCGTT
    NB15CAGTGGTGTTAGCGAGGTAGACCT
    NB16AGTACGAACCACTGTCAGTTGACG
    NB17ATCAGAGGTACTTTCCTGGAGGGT
    NB18GCCTATCTAGGTTGTTGGGTTTGG
    NB19ATCTCTTGACACTGCACGAGGAAC
    NB20ATGAGTTCTCGTAACAGGACGCAA
    NB21TAGAGAACGGACAATGAGAGGCTC
    NB22CGTACTTTGATACATGGCAGTGGT
    NB23CGAGGAGGTTCACTGGGTAGTAAG
    NB24CTAACCCATCATGCAGAACTATGC

     

     

    Barcode flanking sequences

    In addition to the barcodes themselves, the barcoding primers have additional flanking sequences, which add an extra level of context during analysis. The flanking sequences differ depending on the kit:

    Native Barcoding Expansion 1-12 (EXP-NBD104) and Native Barcoding Expansion 13-24

    5' - AAGGTT - barcode - ACAGCACCT - 3'

Copyright © 2013, INRA | Designed by GenoToul Bioinfo, GenoToul Genomic and Sigenae teams | Optimized for