nG6 is a Next Generation Sequencing data repository allowing to store raw data and associated analyses.

nG6 uses project, run and analysis levels. A run represents a sequencing unit (e.g. a lane of an Illumina flowcell or a region of a Roche 454 PTP). Analyses are linked to a run, and a project contains one or more runs, as well as analyses.

nG6 frontend access is restricted by a login form.

You can learn more about nG6 reading the publication in BMC Genomics.

You can access your username and change your password using this web interface.

User access is managed at the project level. Three roles exist : 

• a "Member" can access and download run and analysis data linked to a project
• a "Manager" has "Member" rights and can add or remove users from the project he manages (e.g. it allows a researcher to give access to their NGS data to a bioinformatician)
• an "Administrator" has "Manager" right and can add or remove runs and/or analysis to the project

Each user can update its contact information and/or password : 

• connect to ng6
• enter a project
• click the "Users" tab
• check the checkbox of the account to modify
• click the "Update User" button
• change the contact information and/or the password in the form
• click the "Save" button

If the NGS data was produced on the GeT-PlaGe core facility, the research team login from GeT-PlaGe has to be used to connect to nG6, with the same password (synchronization from GeT-PlaGe database to nG6 database is done every 20 minutes). Please note that for these accounts, the reference database is the one from GeT-PlaGe and the contact information and/or password must be updated connecting to http://get.genotoul.fr/index.php?id=209.

If you want to give access to your data in nG6 to your colleagues, you can add users : 

• Connect to ng6 frontend
• click on "Projects" menu
• click on the project you want to share
• click on "Users" tab
• click on the "Add user" button
• Fill in the form, for each input of the form (last and first names, login, e-mail), nG6 will suggest a list of account of its database corresponding to the characters you entered
  • if the user you want to add has already an account in nG6, select its account in one of the dropdown boxes
    • nG6 will fill in the whole form as you can check that the account you selected is the one you expected. If you agree, click on the "Add" button
  • if the user you want to add does not have an account in nG6, fill in all he inputs of the form and click on the "Add" button

Note : an Administrator can add a user with administrator, Manager or Member role. A Manager can add a user with Manager or Member role.

To remove a user from a project, check the select box of the corresponding user and click on the "Delete user" button

Several solutions are available : 

On Run/Analysis page :

while accessing your runs/analysis, you can download the files by clicking the available html links in "Download" section, but be aware that if the file is too heavy, the download can take a long time

On Download page (https://ng6.toulouse.inra.fr/download):

1. Select the data you want to access by clicking the corresponding checkboxes inside the project/run.
2. Then, at top of the page on Available downloads field : select your download method between URL and Symbolic links, they are described below. The last one, archive, is obsolete.
3. Finally validate the form with "Download".

Then,

 

• You work on Windows station, then go to FAQ entry "How to get my data if I work on Windows station?"

• You have a valid ldap account on the Bioinformatics Genotoul platform, allowing you to use the cluster (account which is different from the one you use to connect on this web interface), then go to FAQ entry "How to get my data with my Bioinformatics Genotoul platform account ?"

• You work on your own Linux station, then go to FAQ entry "How to get my data with URL on linux station?"

You can follow this tutorial if you have a valid account on the Bioinformatics Genotoul platform.

On Download page (https://ng6.toulouse.inra.fr/download):

1. Select the data you want to access by clicking the corresponding checkboxes inside the project/run.
2. Then, at top of the page on Available downloads field : select Symbolic links
3. Finally validate the form with "Download".

A dialog box asks you

1. Select the server where to create the cymbolic links to your data (old infrastructure : genologin.toulouse.inra.fr or new infrastructure : genobioinfo.toulouse.inrae.fr)
2. a login/password couple existing in the Bioinformatics Genotoul platform
3. a repository where the symbolic links will be created on the genotoul server. It should be :
   • on the /work space
   • on a folder where YOU can access in writing mode, eg. /work/MyUsername/projectX/ on genologin or /work/user/MyUsername/projectX/ on genobioinfo

The data is written in one folder per project + one folder per run + one folder per analyze. You can then analyze your data on the genotoul infrastructure or download them. 

Dowloading the data can be achieved from the genologin/genobioinfo cluster

1. Connect on the Bioinformatics Genotoul server : ssh your_login@genobioinfo.toulouse.inrae.fr
2. Connect on a node of the cluster : srun --pty bash
3. Run the command : rsync -avLh /work/pathToYourTopFolderWithSymbolicLinks your_server_login@your_server_name:/path_on_your_server

Dowloading the data can also be achieved from your windows/Mac workstation

Use a GUI like FileZilla to transfer your data from genobioinfo.toulouse.inrae.fr (cf "Files transfert from/to the platform" FAQ entry on the bioinfo.genotoul.fr website) 

 

If you want to create a Bioinformatics Genotoul platform user account, please see http://bioinfo.genotoul.fr/index.php/ask-for/create-an-account/

It seems hard but it works. You can always contact your bioinformatician or the ng6 support team if needed!

On your computer,

•     Create a folder called NG6Download, if possible in your C:\Users\session_name folder
• In this folder,
•     download the archive for curl (https://curl.se/windows/)
•     extract this archive in a folder called "curl", so that the executable is accessible at the following location curl\bin\curl.exe

On NG6 website, on the Download tab (https://ng6.toulouse.inra.fr/download ):

•     Select "url" for Available downloads
•     Select the run/analysis from which you want the files
•     Click on "Download"

  > A window should display the URL list (which may contains more or less files...)

•   Copy all the URL given by ng6 (CTRL+A then CTRL+C on the keyboard)
•   Open a file with Notepad (Bloc-Notes in French)
•   Paste the URL list (CTRL+V on the keyboard) on the notepad
•   Save this file as URLList.txt in the NG6Download folder

WARNING : if the same filename is found in different URL, the local file will be overriden. In other words, if you selected multiple analyses containing a file "archive.gz" they will all be downloaded in the same folder, so the archive.gz will be overriden. > Create one folder by analysis.

Open a Windows prompt ("Invite de commande"); it will open in your C:\Users\session_name folder. Write the following :

•          cd NG6Download

    > You are now in the NG6Download folder. Now write the following

•          for /f %d in (URLList.txt) do curl\bin\curl.exe --output-dir . -O %d

    > Your files are being downloaded

 Of course, you can name folders and files as you want, it was easier to write an example with defined names.

 

Troubleshooting :

• if you get the message "The specified path does not exist" or "Le chemin d’accès spécifié est introuvable." please check the curl.exe file is accessible in the folder curl\bin (inside NG6Download folder). If not, please correct the command line "for /f %d in (URLList.txt) do curl\bin\curl.exe --output-dir . -O %d" so that the curl.exe can be found (you can specify the absolute path)

On Download page (https://ng6.toulouse.inra.fr/download):

1. Select the data you want to access by clicking the corresponding checkboxes inside the project/run.
2. Then, at top of the page on Available downloads field : select URL
3. Finally validate the form with "Download".

A url list of each file of your project will be created. Copy/paste this list in a file "listOfFiles" (Be aware that if the same filename is found in different url, the local file will be overriden). Then, use one of the following command to download all the files :

•    wget -i listOfFiles

•    cat listOfFiles | xargs -i curl -O {}

Your data is stored on a Dell NAS in the INRA campus, replicated once a day on another Dell NAS stored in a datacenter in a distant site.

Passwords in the database are hashed and the communication between your browser and nG6 is encrypted.

The data retention period depends on the project's space, and the default retention is set to 3 months.

You will receive a reminder email a month before your data exceed the retention limit.

When the library insert length is smaller than the sequencing read length, you can find the sequencing adapaters the end of your reads.

You can find the different sequencing adapters below :

• TruSeq Adapter - Read 1 : "GATCGGAAGAG-CACACGTCTGAACTCCAGTC"
• Illumina single End PCR Primer - Read 2 : "GATCGGAAGAG-CGTCGTGTAGGGAAAGAGTG"
• Nextera  transposase sequence - Read 1 : 5’ TCGTCGGCAGCGTC-AGATGTGTATAAGAGACAG
• Nextera  transposase sequence - Read 2 : 5’ GTCTCGTGGGCTCGG-AGATGTGTATAAGAGACAG

You can use cutadapt to remove the adapter sequences, specifying the following sequences : 

• Nextera index : CTGTCTCTTATACACATCT
• Illlumina Index : AGATCGGAAGAGC

 

Today (03/05/2019), Nanopore reads on nG6 can contain the adapters and barcodes.

You can find the different sequencing adapters for the Ligation Sequencing Kit (kit code SQK-LSK109) below :

Adapter Y top:

5'- GGCGTCTGCTTGGGTGTTTAACCTTTTTTTTTTAATGTACTTCGTTCAGTTACGTATTGCT -3'

Adapter Y bottom:

5'- GCAATACGTAACTGAACGAAGT -3'

 

You can find the different barcoding sequences :

Only for multiplexed run !

Native Barcoding Expansion 1-12

 

Native Barcoding Expansion 13-24

Native Barcoding Expansion 1-12 (EXP-NBD104) and Native Barcoding Expansion 13-24

5' - AAGGTT - barcode - ACAGCACCT - 3'

Every project is linked to a "space". A space is defined by a strorage directory, a retention duration and a purge policy.
You can check your project's space on the project's page.
 
There are currently 4 spaces:

•  shortterm : the default space. Data are kept for 4 months, but metadata will still be available.
•  longterm_get : for projects handled by GeT. Data will be, by default, kept 2 years. It is dedicated to collaboration projects with GeT. Storage cost is evaluated during project definition.
• longterm_bioinfo : for projects handled by the bioinfomatics platform (http://bioinfo.genotoul.fr/). Project owners will be billled during the annual purge process, depending on the data size used and the requested storage duration.
• seqoccin : the SeqOccIn storage space is dedicated to the seqOccIn projet. Data will be stored until December 31st 2022.

 
One month before a project's data reach their retention limit, all users linked to the project will receive a purge alert mail from 'ng6-support@groupes.renater.fr' to warn and remind them to download the produced data.
 
There is a purge campaign every month for projects in the shorterm space, and an annual purge campaign for longterm spaces.
 
Even if the raw data are deleted during the purge process, metadata are kept and stay accessible on the NG6 website with your credentials.